Transcript: Mouse XM_006511207.3

PREDICTED: Mus musculus ELMO/CED-12 domain containing 1 (Elmod1), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Elmod1 (270162)
Length:
2696
CDS:
469..1431

Additional Resources:

NCBI RefSeq record:
XM_006511207.3
NBCI Gene record:
Elmod1 (270162)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006511207.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000248310 GCTATTTGATGCACGAGTTTC pLKO_005 1259 CDS 100% 10.800 15.120 N Elmod1 n/a
2 TRCN0000248311 ATCACCGACCTGGCATATAAT pLKO_005 1153 CDS 100% 15.000 10.500 N Elmod1 n/a
3 TRCN0000248307 ATGCACATAAGTGACTATATA pLKO_005 1517 3UTR 100% 15.000 10.500 N Elmod1 n/a
4 TRCN0000248308 ATGGACATAATGGAGTTTAAT pLKO_005 1306 CDS 100% 15.000 10.500 N Elmod1 n/a
5 TRCN0000248309 ATTCCGCAAGAGGATCATAAA pLKO_005 1341 CDS 100% 13.200 9.240 N Elmod1 n/a
6 TRCN0000192437 CTTTGCAATTGTGGGCATCAA pLKO.1 1131 CDS 100% 4.950 3.465 N Elmod1 n/a
7 TRCN0000190936 CAATATCACCGACCTGGCATA pLKO.1 1149 CDS 100% 4.050 2.835 N Elmod1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006511207.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12222 pDONR223 100% 73.9% 80.7% None (many diffs) n/a
2 ccsbBroad304_12222 pLX_304 0% 73.9% 80.7% V5 (many diffs) n/a
3 TRCN0000491804 ATGACGGTAAGCCACACGTCGGGC pLX_317 46.7% 73.9% 80.7% V5 (many diffs) n/a
Download CSV