Transcript: Mouse XM_006511462.3

PREDICTED: Mus musculus solute carrier family 35, member F2 (Slc35f2), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Slc35f2 (72022)
Length:
2258
CDS:
89..1075

Additional Resources:

NCBI RefSeq record:
XM_006511462.3
NBCI Gene record:
Slc35f2 (72022)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006511462.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000068900 GCCGATGTGGAAGCCAATTAT pLKO.1 296 CDS 100% 15.000 21.000 N Slc35f2 n/a
2 TRCN0000068899 CCGGGCAAGATACAAAGTGAT pLKO.1 415 CDS 100% 4.950 3.960 N Slc35f2 n/a
3 TRCN0000044644 CAGCTATTGATTGTGGAATAT pLKO.1 674 CDS 100% 13.200 9.240 N SLC35F2 n/a
4 TRCN0000290563 CAGCTATTGATTGTGGAATAT pLKO_005 674 CDS 100% 13.200 9.240 N SLC35F2 n/a
5 TRCN0000068898 GCCCTGTTATTTGTGGCATTT pLKO.1 731 CDS 100% 10.800 7.560 N Slc35f2 n/a
6 TRCN0000068901 CCAGCCAGTATTTGGCAGAAA pLKO.1 123 CDS 100% 4.950 3.465 N Slc35f2 n/a
7 TRCN0000068902 GCTGTGTCTAACGTGTGTGAA pLKO.1 575 CDS 100% 4.950 3.465 N Slc35f2 n/a
8 TRCN0000044647 CCTGTACAGCTTCATGCCATT pLKO.1 769 CDS 100% 4.050 2.430 N SLC35F2 n/a
9 TRCN0000290623 CCTGTACAGCTTCATGCCATT pLKO_005 769 CDS 100% 4.050 2.430 N SLC35F2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006511462.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03451 pDONR223 100% 74.4% 80.2% None (many diffs) n/a
2 ccsbBroad304_03451 pLX_304 0% 74.4% 80.2% V5 (many diffs) n/a
3 TRCN0000474063 GGCGCCGAAGGCGATCCGCGCGTT pLX_317 45.6% 74.4% 80.2% V5 (many diffs) n/a
Download CSV