Transcript: Mouse XM_006511635.1

PREDICTED: Mus musculus cytokine inducible SH2-containing protein (Cish), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cish (12700)
Length:
3090
CDS:
1051..2028

Additional Resources:

NCBI RefSeq record:
XM_006511635.1
NBCI Gene record:
Cish (12700)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006511635.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000055361 ACATCTGTGTCGGCTAGTCAT pLKO.1 1923 CDS 100% 4.950 6.930 N Cish n/a
2 TRCN0000055359 CTGTTCACACTGTCAGTCAAA pLKO.1 1597 CDS 100% 4.950 3.465 N Cish n/a
3 TRCN0000055360 CCTGCCTATGTCTAAGCAAGA pLKO.1 1803 CDS 100% 4.050 2.835 N Cish n/a
4 TRCN0000055358 CATAGCCAAGACGTTCTCCTA pLKO.1 1461 CDS 100% 2.640 1.848 N Cish n/a
5 TRCN0000055362 CCAGGCAGAGAATGAACCGAA pLKO.1 1410 CDS 100% 2.640 1.584 N Cish n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006511635.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06007 pDONR223 100% 67.7% 69.4% None (many diffs) n/a
2 ccsbBroad304_06007 pLX_304 0% 67.7% 69.4% V5 (many diffs) n/a
3 TRCN0000473621 CTACGGTGTAACCGCTGGTACTCG pLX_317 67.3% 67.7% 69.4% V5 (many diffs) n/a
Download CSV