Transcript: Mouse XM_006511924.3

PREDICTED: Mus musculus acetyl-Coenzyme A acyltransferase 1A (Acaa1a), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Acaa1a (113868)
Length:
1673
CDS:
592..1410

Additional Resources:

NCBI RefSeq record:
XM_006511924.3
NBCI Gene record:
Acaa1a (113868)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006511924.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000183781 CACAGCACTTTACTTTAGAAA pLKO.1 1515 3UTR 100% 5.625 3.375 N Acaa1a n/a
2 TRCN0000246457 CACAGCACTTTACTTTAGAAA pLKO_005 1515 3UTR 100% 5.625 3.375 N Acaa1a n/a
3 TRCN0000246459 CTCCGTGGGCAATGTTCTTGA pLKO_005 436 5UTR 100% 4.950 2.970 N Acaa1a n/a
4 TRCN0000246456 TGGCACGCATCGCCCAATTTC pLKO_005 477 5UTR 100% 4.400 2.640 N Acaa1a n/a
5 TRCN0000248120 AGGTTGTCACGCTACTCAATG pLKO_005 1292 CDS 100% 10.800 5.400 Y Acaa1b n/a
6 TRCN0000248123 GGCTGACTGTGAATGACATAG pLKO_005 1133 CDS 100% 10.800 5.400 Y Acaa1b n/a
7 TRCN0000246458 TAGACATCTTTGAGATCAATG pLKO_005 1151 CDS 100% 10.800 5.400 Y Acaa1a n/a
8 TRCN0000183604 GTGAATGACATAGACATCTTT pLKO.1 1141 CDS 100% 5.625 2.813 Y Acaa1a n/a
9 TRCN0000183840 CATAGACATCTTTGAGATCAA pLKO.1 1149 CDS 100% 4.950 2.475 Y Acaa1a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006511924.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00004 pDONR223 100% 55.6% 56.1% None (many diffs) n/a
2 TRCN0000479705 CATTGCATGACGAAACGACATTCC pLX_317 24.5% 55.6% 56.1% V5 (many diffs) n/a
Download CSV