Transcript: Mouse XM_006512076.3

PREDICTED: Mus musculus plexin B1 (Plxnb1), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Plxnb1 (235611)
Length:
8745
CDS:
421..6780

Additional Resources:

NCBI RefSeq record:
XM_006512076.3
NBCI Gene record:
Plxnb1 (235611)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006512076.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000078917 CTTGAATACTTCACGGACATA pLKO.1 5317 CDS 100% 4.950 6.930 N Plxnb1 n/a
2 TRCN0000078914 CCCATCAACAAACTTCTGTAT pLKO.1 6466 CDS 100% 4.950 3.465 N Plxnb1 n/a
3 TRCN0000078916 CGTCTGAATACACTGCAACAT pLKO.1 5866 CDS 100% 4.950 3.465 N Plxnb1 n/a
4 TRCN0000078915 CCAGCCTACTAACAACCCTAA pLKO.1 693 CDS 100% 4.050 2.835 N Plxnb1 n/a
5 TRCN0000078913 GCCATTCATGTTCCATGAATT pLKO.1 7745 3UTR 100% 0.000 0.000 N Plxnb1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006512076.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11036 pDONR223 100% 3.5% 3.3% None (many diffs) n/a
2 ccsbBroad304_11036 pLX_304 0% 3.5% 3.3% V5 (many diffs) n/a
Download CSV