Transcript: Mouse XM_006512125.2

PREDICTED: Mus musculus myosin VIIA and Rab interacting protein (Myrip), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Myrip (245049)
Length:
5976
CDS:
109..2679

Additional Resources:

NCBI RefSeq record:
XM_006512125.2
NBCI Gene record:
Myrip (245049)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006512125.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000415083 GGGAATTTGAGACCGAATATC pLKO_005 2911 3UTR 100% 13.200 18.480 N Myrip n/a
2 TRCN0000431992 CCATCACTTAGTCGTGCTTAT pLKO_005 3115 3UTR 100% 10.800 15.120 N Myrip n/a
3 TRCN0000091477 AGGAGGATTGTTTGAACCAAA pLKO.1 579 CDS 100% 4.950 3.960 N Myrip n/a
4 TRCN0000091473 CCTGCCAAATTCAACAAGATT pLKO.1 3499 3UTR 100% 5.625 3.938 N Myrip n/a
5 TRCN0000091476 CTGTATGAGTTAGCCATGAAA pLKO.1 1858 CDS 100% 5.625 3.938 N Myrip n/a
6 TRCN0000091474 GCTCGGATTCAGAGACATCTT pLKO.1 1454 CDS 100% 4.950 3.465 N Myrip n/a
7 TRCN0000091475 AGAGACTTCAATCTTCGCAAA pLKO.1 178 CDS 100% 4.050 2.835 N Myrip n/a
8 TRCN0000421783 CCTGACCATCGCTGGCTTAAA pLKO_005 2391 CDS 100% 13.200 7.920 N Myrip n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006512125.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.