Transcript: Mouse XM_006512457.3

PREDICTED: Mus musculus regulator of G-protein signaling 17 (Rgs17), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rgs17 (56533)
Length:
8069
CDS:
271..903

Additional Resources:

NCBI RefSeq record:
XM_006512457.3
NBCI Gene record:
Rgs17 (56533)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006512457.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000037169 CCAGGATGATATACGAGGATT pLKO.1 668 CDS 100% 4.950 6.930 N Rgs17 n/a
2 TRCN0000352259 CCAGGATGATATACGAGGATT pLKO_005 668 CDS 100% 4.950 6.930 N Rgs17 n/a
3 TRCN0000348905 GACAATGAATTGCCAAATTAA pLKO_005 1116 3UTR 100% 15.000 10.500 N Rgs17 n/a
4 TRCN0000348840 CTGTACTTCTGAATCCTAATT pLKO_005 885 CDS 100% 13.200 9.240 N Rgs17 n/a
5 TRCN0000037173 GAAACCAAAGGCCCAACAATA pLKO.1 329 CDS 100% 13.200 9.240 N Rgs17 n/a
6 TRCN0000037171 CAGAGATTCTTTCCCAAGATT pLKO.1 819 CDS 100% 5.625 3.938 N Rgs17 n/a
7 TRCN0000352185 CAGAGATTCTTTCCCAAGATT pLKO_005 819 CDS 100% 5.625 3.938 N Rgs17 n/a
8 TRCN0000037170 CCACCAGCTGTACTTCTGAAT pLKO.1 878 CDS 100% 4.950 3.465 N Rgs17 n/a
9 TRCN0000348839 TTGAACTCACAGATCTATAAA pLKO_005 841 CDS 100% 15.000 9.000 N Rgs17 n/a
10 TRCN0000307292 GAGTTAGAGAGGTGATCAATA pLKO_005 731 CDS 100% 13.200 9.240 N RGS17 n/a
11 TRCN0000037172 GAGAACCTACTCTTCTGGCTA pLKO.1 595 CDS 100% 2.640 1.848 N Rgs17 n/a
12 TRCN0000166364 CACACACACACACACACACAA pLKO.1 5905 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006512457.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14110 pDONR223 100% 87.3% 2.2% None (many diffs) n/a
2 ccsbBroad304_14110 pLX_304 0% 87.3% 2.2% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000468023 CATCGGGCAGCAATTCCGGAGTTC pLX_317 72.8% 87.3% 2.2% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV