Transcript: Mouse XM_006512569.3

PREDICTED: Mus musculus mannosidase 1, alpha (Man1a), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Man1a (17155)
Length:
5129
CDS:
510..2477

Additional Resources:

NCBI RefSeq record:
XM_006512569.3
NBCI Gene record:
Man1a (17155)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006512569.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000018472 CCGGAAGCGTTTCGATTTGAT pLKO.1 2076 CDS 100% 5.625 7.875 N Man1a n/a
2 TRCN0000294542 CCGGAAGCGTTTCGATTTGAT pLKO_005 2076 CDS 100% 5.625 7.875 N Man1a n/a
3 TRCN0000018471 CAATAGTAGATGCCCTGGATA pLKO.1 1234 CDS 100% 4.950 6.930 N Man1a n/a
4 TRCN0000055386 CCCGCACTTGTCATGAATCTT pLKO.1 2029 CDS 100% 5.625 4.500 N Man1a n/a
5 TRCN0000055384 GTTATGACGATGTCCAGCAAA pLKO.1 2305 CDS 100% 4.950 3.960 N Man1a n/a
6 TRCN0000287163 GTTATGACGATGTCCAGCAAA pLKO_005 2305 CDS 100% 4.950 3.960 N Man1a n/a
7 TRCN0000018474 GCTTGAACGAACTGAAACCTA pLKO.1 1162 CDS 100% 3.000 2.400 N Man1a n/a
8 TRCN0000294544 GCTTGAACGAACTGAAACCTA pLKO_005 1162 CDS 100% 3.000 2.400 N Man1a n/a
9 TRCN0000055385 CCGTGAACAGAAGAAGGAAAT pLKO.1 2438 CDS 100% 10.800 7.560 N Man1a n/a
10 TRCN0000049600 CCTTTATCCTAACTATCTGAA pLKO.1 1679 CDS 100% 4.950 3.465 N MAN1A1 n/a
11 TRCN0000055383 CGAAAGAAAGCAGTGGAACTT pLKO.1 1419 CDS 100% 4.950 3.465 N Man1a n/a
12 TRCN0000018473 GTGTTGAACAAACTGGACAAA pLKO.1 1650 CDS 100% 4.950 3.465 N Man1a n/a
13 TRCN0000018470 CCTTTCCCTATACTCCGTGAA pLKO.1 2424 CDS 100% 4.050 2.835 N Man1a n/a
14 TRCN0000294628 CCTTTCCCTATACTCCGTGAA pLKO_005 2424 CDS 100% 4.050 2.835 N Man1a n/a
15 TRCN0000055387 GCTGGTGTTCAGCGCCTTCAT pLKO.1 650 CDS 100% 1.650 1.155 N Man1a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006512569.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10957 pDONR223 100% 45% 44.5% None (many diffs) n/a
2 ccsbBroad304_10957 pLX_304 0% 45% 44.5% V5 (many diffs) n/a
Download CSV