Transcript: Mouse XM_006512673.3

PREDICTED: Mus musculus phosphatase and actin regulator 2 (Phactr2), transcript variant X8, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Phactr2 (215789)
Length:
3603
CDS:
240..2360

Additional Resources:

NCBI RefSeq record:
XM_006512673.3
NBCI Gene record:
Phactr2 (215789)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006512673.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000253570 ATGAAGAGAGTCGACAGTTTA pLKO_005 2320 CDS 100% 13.200 18.480 N Phactr2 n/a
2 TRCN0000265404 TTCTGACACGCCTAGTCTTAA pLKO_005 1316 CDS 100% 13.200 18.480 N Phactr2 n/a
3 TRCN0000253571 TAGAGCAAAGAAACATCTTAA pLKO_005 2044 CDS 100% 13.200 9.240 N Phactr2 n/a
4 TRCN0000253572 CGTGGAACTGCTCGGAAATAA pLKO_005 2366 3UTR 100% 15.000 9.000 N Phactr2 n/a
5 TRCN0000063714 GAAGAAGATGATGATGATGAT pLKO.1 1821 CDS 100% 4.950 2.475 Y SET n/a
6 TRCN0000288612 GAAGAAGATGATGATGATGAT pLKO_005 1821 CDS 100% 4.950 2.475 Y SET n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006512673.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07480 pDONR223 100% 75.8% 73.7% None (many diffs) n/a
2 ccsbBroad304_07480 pLX_304 0% 75.8% 73.7% V5 (many diffs) n/a
3 TRCN0000478114 CAGTGCCTATAGTGCAGTAAGCAT pLX_317 15.2% 75.8% 73.7% V5 (many diffs) n/a
Download CSV