Transcript: Mouse XM_006512748.2

PREDICTED: Mus musculus zinc finger and BTB domain containing 24 (Zbtb24), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Zbtb24 (268294)
Length:
1744
CDS:
205..1653

Additional Resources:

NCBI RefSeq record:
XM_006512748.2
NBCI Gene record:
Zbtb24 (268294)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006512748.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000095542 GAAGCCATTTACTTGTGAAAT pLKO.1 1494 CDS 100% 13.200 9.240 N Zbtb24 n/a
2 TRCN0000095543 CAAAGGAAGAAGGGCTTTCTT pLKO.1 292 CDS 100% 0.563 0.394 N Zbtb24 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006512748.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02258 pDONR223 100% 57.6% 55.4% None (many diffs) n/a
2 ccsbBroad304_02258 pLX_304 0% 57.6% 55.4% V5 (many diffs) n/a
3 TRCN0000480386 GATGCATTTGGTTTGTCTGCCCTC pLX_317 19.3% 57.6% 55.4% V5 (many diffs) n/a
Download CSV