Transcript: Mouse XM_006512804.2

PREDICTED: Mus musculus Hbs1-like (S. cerevisiae) (Hbs1l), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Hbs1l (56422)
Length:
2336
CDS:
134..1711

Additional Resources:

NCBI RefSeq record:
XM_006512804.2
NBCI Gene record:
Hbs1l (56422)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006512804.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000250812 ATTGAAGTTCCGATCACTAAA pLKO_005 1415 CDS 100% 13.200 18.480 N Hbs1l n/a
2 TRCN0000250813 CTGTTATTAAGCGATTGATTA pLKO_005 1479 CDS 100% 13.200 18.480 N Hbs1l n/a
3 TRCN0000217852 GTTAGCTGCCAACAAGTATTA pLKO.1 1868 3UTR 100% 13.200 18.480 N Hbs1l n/a
4 TRCN0000258111 ACGTCGGAATGACGAAGTTTG pLKO_005 627 CDS 100% 10.800 15.120 N Hbs1l n/a
5 TRCN0000202317 GCTCCTCAACTTAGTGGTCAT pLKO.1 424 CDS 100% 4.050 5.670 N Hbs1l n/a
6 TRCN0000191758 GCTGTTATTAAGCGATTGATT pLKO.1 1478 CDS 100% 5.625 4.500 N Hbs1l n/a
7 TRCN0000250811 TTAGCTGCCAACAAGTATTAA pLKO_005 1869 3UTR 100% 15.000 10.500 N Hbs1l n/a
8 TRCN0000250814 GGCGGTTTATGCTGCGTTATG pLKO_005 1635 CDS 100% 10.800 7.560 N Hbs1l n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006512804.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02521 pDONR223 100% 65.1% 68.9% None (many diffs) n/a
2 ccsbBroad304_02521 pLX_304 0% 65.1% 68.9% V5 (many diffs) n/a
3 TRCN0000476887 CTCATTAGAGTGAGAAGAGATGTA pLX_317 17.9% 65.1% 68.9% V5 (many diffs) n/a
Download CSV