Transcript: Mouse XM_006512983.3

PREDICTED: Mus musculus solute carrier family 6 (neurotransmitter transporter), member 15 (Slc6a15), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Slc6a15 (103098)
Length:
2983
CDS:
284..2473

Additional Resources:

NCBI RefSeq record:
XM_006512983.3
NBCI Gene record:
Slc6a15 (103098)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006512983.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000079722 GTGACAATGTTTGACGATTAT pLKO.1 1844 CDS 100% 13.200 18.480 N Slc6a15 n/a
2 TRCN0000079721 CGTGACAATGTTTGACGATTA pLKO.1 1843 CDS 100% 10.800 15.120 N Slc6a15 n/a
3 TRCN0000079718 GCTTACATTGACTGAGGTCAT pLKO.1 2667 3UTR 100% 4.050 5.670 N Slc6a15 n/a
4 TRCN0000079720 CGGCAGCATGTTTGGAACAAT pLKO.1 1699 CDS 100% 5.625 4.500 N Slc6a15 n/a
5 TRCN0000079719 GCTTTGTTTATGGCATAGATA pLKO.1 1917 CDS 100% 5.625 3.938 N Slc6a15 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006512983.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03527 pDONR223 100% 86.7% 91.5% None (many diffs) n/a
2 ccsbBroad304_03527 pLX_304 0% 86.7% 91.5% V5 (many diffs) n/a
3 TRCN0000471292 TTGCGAAGCCCGGTTCGCTTTGCC pLX_317 18.8% 86.7% 91.5% V5 (many diffs) n/a
Download CSV