Transcript: Mouse XM_006513017.3

PREDICTED: Mus musculus 5'-nucleotidase domain containing 3 (Nt5dc3), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Nt5dc3 (103466)
Length:
1236
CDS:
119..1114

Additional Resources:

NCBI RefSeq record:
XM_006513017.3
NBCI Gene record:
Nt5dc3 (103466)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006513017.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000366661 CGAGCAATCGAAGCGGATATT pLKO_005 905 CDS 100% 13.200 18.480 N Nt5dc3 n/a
2 TRCN0000376801 GCCTGTCAGACATCGAAATAT pLKO_005 387 CDS 100% 15.000 12.000 N Nt5dc3 n/a
3 TRCN0000375542 ATTACACCCTGGTATTCTATT pLKO_005 423 CDS 100% 13.200 10.560 N Nt5dc3 n/a
4 TRCN0000366660 AGACGTCAAGGACTCCATAAG pLKO_005 856 CDS 100% 10.800 7.560 N Nt5dc3 n/a
5 TRCN0000375611 TGAAGAACAACATTGACTATG pLKO_005 816 CDS 100% 10.800 6.480 N Nt5dc3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006513017.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03334 pDONR223 100% 49.9% 48.7% None (many diffs) n/a
2 ccsbBroad304_03334 pLX_304 0% 49.9% 48.7% V5 (many diffs) n/a
3 TRCN0000477695 TGCACGACCCTAAAAAGAGGGTAT pLX_317 8.7% 49.9% 48.7% V5 (many diffs) n/a
Download CSV