Transcript: Mouse XM_006513389.2

PREDICTED: Mus musculus retinol dehydrogenase 16 (Rdh16), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rdh16 (19683)
Length:
1246
CDS:
109..1062

Additional Resources:

NCBI RefSeq record:
XM_006513389.2
NBCI Gene record:
Rdh16 (19683)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006513389.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000041945 ATGGGTCGAGTGTCTCTCTTT pLKO.1 604 CDS 100% 4.950 3.465 N Rdh16 n/a
2 TRCN0000041944 CCAAGACAAATATGTCTTCAT pLKO.1 189 CDS 100% 0.495 0.297 N Rdh16 n/a
3 TRCN0000445030 GGGTGAAGGTGGCTATTATAG pLKO_005 701 CDS 100% 13.200 6.600 Y Rdh16 n/a
4 TRCN0000041456 GTGCCAGATTATGCTCAAATA pLKO.1 755 CDS 100% 13.200 6.600 Y Rdh16f2 n/a
5 TRCN0000041947 GTGAGCCATCTCCAAGACAAA pLKO.1 178 CDS 100% 4.950 2.475 Y Rdh16 n/a
6 TRCN0000041946 CAGCTCAGAAATCAGGGAGAT pLKO.1 798 CDS 100% 4.050 2.025 Y Rdh16 n/a
7 TRCN0000190157 GCTGAGGAACAAGACATCTGA pLKO.1 312 CDS 100% 3.000 1.500 Y Rdh18-ps n/a
8 TRCN0000202357 GAACAAGACATCTGACAGGCT pLKO.1 318 CDS 100% 0.660 0.330 Y Rdh18-ps n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006513389.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.