Transcript: Mouse XM_006513526.2

PREDICTED: Mus musculus centrosomal protein 290 (Cep290), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cep290 (216274)
Length:
9062
CDS:
234..8504

Additional Resources:

NCBI RefSeq record:
XM_006513526.2
NBCI Gene record:
Cep290 (216274)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006513526.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000141540 CAGTGACTACCGATCACAGTT pLKO.1 815 CDS 100% 4.950 3.465 N CEP290 n/a
2 TRCN0000276332 CAGTGACTACCGATCACAGTT pLKO_005 815 CDS 100% 4.950 3.465 N CEP290 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006513526.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14281 pDONR223 100% 5.2% 5.4% None (many diffs) n/a
2 ccsbBroad304_14281 pLX_304 0% 5.2% 5.4% V5 (many diffs) n/a
3 TRCN0000473474 TTGTATCTCTTCCGAGTCCTCCGT pLX_317 71.2% 5.2% 5.4% V5 (many diffs) n/a
Download CSV