Transcript: Mouse XM_006513760.3

PREDICTED: Mus musculus anoctamin 4 (Ano4), transcript variant X6, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ano4 (320091)
Length:
3091
CDS:
339..3014

Additional Resources:

NCBI RefSeq record:
XM_006513760.3
NBCI Gene record:
Ano4 (320091)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006513760.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000248385 GGATCTTGTCAGGCGATATTT pLKO_005 1943 CDS 100% 15.000 21.000 N Ano4 n/a
2 TRCN0000190752 GCTGTAAACCACCGACATCTA pLKO.1 1872 CDS 100% 4.950 6.930 N Ano4 n/a
3 TRCN0000248384 TTCATGAGCAGGATCGATAAA pLKO_005 1527 CDS 100% 13.200 10.560 N Ano4 n/a
4 TRCN0000190606 GCAAAGCCATCAGCTGGATAT pLKO.1 1007 CDS 100% 10.800 7.560 N Ano4 n/a
5 TRCN0000167227 CACTTCATCATACACAACAAA pLKO.1 1668 CDS 100% 5.625 3.938 N ANO4 n/a
6 TRCN0000190554 GCTTTCAGACAGCTGTGTCTA pLKO.1 2159 CDS 100% 0.495 0.347 N Ano4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006513760.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13086 pDONR223 100% 55.6% 57.2% None (many diffs) n/a
2 ccsbBroad304_13086 pLX_304 0% 55.6% 57.2% V5 (many diffs) n/a
3 TRCN0000466450 CCACAAACCCTCTGGAGTAGCACA pLX_317 14.4% 55.6% 57.2% V5 (many diffs) n/a
Download CSV