Transcript: Mouse XM_006514042.3

PREDICTED: Mus musculus activating signal cointegrator 1 complex subunit 1 (Ascc1), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ascc1 (69090)
Length:
1372
CDS:
148..1086

Additional Resources:

NCBI RefSeq record:
XM_006514042.3
NBCI Gene record:
Ascc1 (69090)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006514042.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000245397 ACGTTCGATGGACGGAATTAT pLKO_005 141 5UTR 100% 15.000 21.000 N Ascc1 n/a
2 TRCN0000183596 GAGGCTCAATTCTATTCACAT pLKO.1 999 CDS 100% 4.950 6.930 N Ascc1 n/a
3 TRCN0000184617 GAGAACCATGACTGACTGGAT pLKO.1 1102 3UTR 100% 2.640 2.112 N Ascc1 n/a
4 TRCN0000241160 ATCACTGGTCAGCATCGAAAT pLKO_005 325 CDS 100% 10.800 7.560 N Ascc1 n/a
5 TRCN0000241158 CATGAAGAAGACGAGGATTTC pLKO_005 195 CDS 100% 10.800 7.560 N Ascc1 n/a
6 TRCN0000241159 CTTGGCTTCTGTCCTTCATTC pLKO_005 1234 3UTR 100% 10.800 7.560 N Ascc1 n/a
7 TRCN0000184635 CCTTGGCTTCTGTCCTTCATT pLKO.1 1233 3UTR 100% 5.625 3.938 N Ascc1 n/a
8 TRCN0000137029 CCTCAATGAAGTTGAGGTTCA pLKO.1 432 CDS 100% 0.405 0.284 N ASCC1 n/a
9 TRCN0000241157 GAGATCCTGCAGCGCTGTAAA pLKO_005 604 CDS 100% 13.200 7.920 N Ascc1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006514042.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.