Transcript: Mouse XM_006514069.3

PREDICTED: Mus musculus DAZ associated protein 1 (Dazap1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Dazap1 (70248)
Length:
2101
CDS:
181..1404

Additional Resources:

NCBI RefSeq record:
XM_006514069.3
NBCI Gene record:
Dazap1 (70248)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006514069.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000375447 GGTTCAACAACAGGGTTTAAA pLKO_005 1584 3UTR 100% 15.000 21.000 N Dazap1 n/a
2 TRCN0000319463 ACCCTAGATGGCCGAAATATC pLKO_005 400 CDS 100% 13.200 18.480 N Dazap1 n/a
3 TRCN0000102336 GAGGTGGTTATGATCTATGAT pLKO.1 601 CDS 100% 5.625 7.875 N Dazap1 n/a
4 TRCN0000317650 GAGGTGGTTATGATCTATGAT pLKO_005 601 CDS 100% 5.625 7.875 N Dazap1 n/a
5 TRCN0000102337 ACACCCTAGATGGCCGAAATA pLKO.1 398 CDS 100% 13.200 10.560 N Dazap1 n/a
6 TRCN0000379305 CACCCTTCACCTCCTACATTG pLKO_005 959 CDS 100% 10.800 7.560 N Dazap1 n/a
7 TRCN0000319464 GCAAATCCAACAAGATCTTTG pLKO_005 509 CDS 100% 10.800 7.560 N Dazap1 n/a
8 TRCN0000102338 CAGGGAGTACTTCAAGAAGTT pLKO.1 567 CDS 100% 4.950 3.465 N Dazap1 n/a
9 TRCN0000317731 CAGGGAGTACTTCAAGAAGTT pLKO_005 567 CDS 100% 4.950 3.465 N Dazap1 n/a
10 TRCN0000102335 CCTTCAGCTTTAATTCAGAAT pLKO.1 1610 3UTR 100% 4.950 3.465 N Dazap1 n/a
11 TRCN0000102339 CAACAAGGATATGGCCCACAA pLKO.1 859 CDS 100% 4.050 2.835 N Dazap1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006514069.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02966 pDONR223 100% 89.1% 98.5% None (many diffs) n/a
2 ccsbBroad304_02966 pLX_304 0% 89.1% 98.5% V5 (many diffs) n/a
3 TRCN0000491423 CCGGTGATCCTGAAGAGTAGAGGC pLX_317 20.5% 89.1% 98.5% V5 (many diffs) n/a
Download CSV