Transcript: Mouse XM_006514113.3

PREDICTED: Mus musculus regulatory factor X, 4 (influences HLA class II expression) (Rfx4), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rfx4 (71137)
Length:
3868
CDS:
322..2559

Additional Resources:

NCBI RefSeq record:
XM_006514113.3
NBCI Gene record:
Rfx4 (71137)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006514113.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000422112 CCAAACGTCAAAGACCTAAAT pLKO_005 895 CDS 100% 13.200 18.480 N Rfx4 n/a
2 TRCN0000414044 TGTTCTTGGACGGGCACATAA pLKO_005 2950 3UTR 100% 13.200 18.480 N Rfx4 n/a
3 TRCN0000075479 CGCTAACATATACAGTAACAA pLKO.1 2009 CDS 100% 5.625 7.875 N Rfx4 n/a
4 TRCN0000422213 CCTTCACCTGGTCCATCATTT pLKO_005 1870 CDS 100% 13.200 9.240 N Rfx4 n/a
5 TRCN0000075481 CCACGAGGTATGGAAACTCTA pLKO.1 2426 CDS 100% 4.950 3.465 N Rfx4 n/a
6 TRCN0000075480 CCTGGATTTCTGTGAGAAGAA pLKO.1 609 CDS 100% 4.950 3.465 N Rfx4 n/a
7 TRCN0000075482 CCCAAATCCTAAGGAGGCAAA pLKO.1 1301 CDS 100% 4.050 2.835 N Rfx4 n/a
8 TRCN0000075478 CCAACTTTGATGAGGTTCAAA pLKO.1 1007 CDS 100% 0.563 0.394 N Rfx4 n/a
9 TRCN0000420092 AGGACAGTCAAAGTACCATTA pLKO_005 717 CDS 100% 10.800 6.480 N RFX4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006514113.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01394 pDONR223 100% 75% 79.5% None (many diffs) n/a
2 ccsbBroad304_01394 pLX_304 0% 75% 79.5% V5 (many diffs) n/a
3 ccsbBroadEn_15565 pDONR223 0% 74.9% 79.4% None (many diffs) n/a
4 ccsbBroad304_15565 pLX_304 0% 74.9% 79.4% V5 (many diffs) n/a
5 TRCN0000480122 CATTCTGCACATTGTCCCCACCCC pLX_317 24% 74.9% 79.4% V5 (many diffs) n/a
Download CSV