Transcript: Mouse XM_006514126.2

PREDICTED: Mus musculus apoptosis-inducing factor, mitochondrion-associated 2 (Aifm2), transcript variant X7, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Aifm2 (71361)
Length:
2956
CDS:
183..1037

Additional Resources:

NCBI RefSeq record:
XM_006514126.2
NBCI Gene record:
Aifm2 (71361)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006514126.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000112138 CAATGAGTATCGGGAGTACAT pLKO.1 563 CDS 100% 4.950 6.930 N Aifm2 n/a
2 TRCN0000112139 CATAGACTTGAAGAACCGGAT pLKO.1 164 5UTR 100% 2.160 3.024 N Aifm2 n/a
3 TRCN0000112136 GCTAGCAATGGTGCTCTGAAA pLKO.1 696 CDS 100% 4.950 3.465 N Aifm2 n/a
4 TRCN0000112137 CAGGGCAAAGTGATTGGCATA pLKO.1 147 5UTR 100% 4.050 2.835 N Aifm2 n/a
5 TRCN0000112135 GCCATGTGAGAACTCTACAGA pLKO.1 2807 3UTR 100% 3.000 2.100 N Aifm2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006514126.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09234 pDONR223 100% 65.6% 68.1% None (many diffs) n/a
2 ccsbBroad304_09234 pLX_304 0% 65.6% 68.1% V5 (many diffs) n/a
3 TRCN0000481067 ACGTCCCCAGTAGGGAACCTACCT pLX_317 47.2% 65.6% 68.1% V5 (many diffs) n/a
Download CSV