Transcript: Mouse XM_006514192.3

PREDICTED: Mus musculus KIF1 binding protein (Kif1bp), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Kif1bp (72320)
Length:
1225
CDS:
78..1067

Additional Resources:

NCBI RefSeq record:
XM_006514192.3
NBCI Gene record:
Kif1bp (72320)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006514192.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000452909 GTTCGAGAAGGCCGCTCATTA pLKO_005 734 CDS 100% 13.200 18.480 N Kif1bp n/a
2 TRCN0000451178 TGTCAGCTGCTAATGTTATTT pLKO_005 883 CDS 100% 15.000 12.000 N Kif1bp n/a
3 TRCN0000181983 CGCTACTCTATCACAGTTCTA pLKO.1 824 CDS 100% 4.950 3.960 N Kif1bp n/a
4 TRCN0000446507 TGAGAAGGTTTATACTCATAA pLKO_005 674 CDS 100% 13.200 9.240 N Kif1bp n/a
5 TRCN0000182249 CCAGCTTGAACACAATGCCTA pLKO.1 776 CDS 100% 2.640 1.848 N Kif1bp n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006514192.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02919 pDONR223 100% 44.3% 47% None (many diffs) n/a
2 ccsbBroad304_02919 pLX_304 0% 44.3% 47% V5 (many diffs) n/a
3 TRCN0000466629 CTCTCGTGCCAGATATTTGGACCA pLX_317 19.5% 44.3% 47% V5 (many diffs) n/a
Download CSV