Transcript: Mouse XM_006514255.3

PREDICTED: Mus musculus glycosyltransferase 8 domain containing 2 (Glt8d2), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Glt8d2 (74782)
Length:
2631
CDS:
655..1710

Additional Resources:

NCBI RefSeq record:
XM_006514255.3
NBCI Gene record:
Glt8d2 (74782)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006514255.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000094011 CCTAGTGTTCACAATGACTTA pLKO.1 1630 CDS 100% 4.950 3.960 N Glt8d2 n/a
2 TRCN0000094012 GCATGAGAAAGTCATCTATTT pLKO.1 1104 CDS 100% 13.200 9.240 N Glt8d2 n/a
3 TRCN0000094010 CGGGAAGTATTCCACCATCAA pLKO.1 1494 CDS 100% 4.950 3.465 N Glt8d2 n/a
4 TRCN0000094013 GACACTCTGTGGGATTCTGTA pLKO.1 711 CDS 100% 4.950 3.465 N Glt8d2 n/a
5 TRCN0000094009 GCCTGGTCTATACAGTGAGTT pLKO.1 2330 3UTR 100% 4.950 2.970 N Glt8d2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006514255.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04272 pDONR223 100% 86.7% 91.7% None (many diffs) n/a
2 ccsbBroad304_04272 pLX_304 0% 86.7% 91.7% V5 (many diffs) n/a
3 TRCN0000481036 CGCGCTGGTGCACCGTAGACTGGC pLX_317 39.4% 86.7% 91.7% V5 (many diffs) n/a
Download CSV