Transcript: Mouse XM_006514298.2

PREDICTED: Mus musculus RIKEN cDNA 2610028H24 gene (2610028H24Rik), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
2610028H24Rik (76964)
Length:
959
CDS:
103..729

Additional Resources:

NCBI RefSeq record:
XM_006514298.2
NBCI Gene record:
2610028H24Rik (76964)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006514298.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000198879 GCAGATGCACCAGATTCTCAT pLKO.1 402 CDS 100% 4.950 3.465 N 2610028H24Rik n/a
2 TRCN0000197734 GAAGGAAGATATTTGGCAGAT pLKO.1 769 3UTR 100% 4.050 2.835 N 2610028H24Rik n/a
3 TRCN0000181509 GAGTGCTTTGAGGAGAAGGAA pLKO.1 22 5UTR 100% 3.000 2.100 N 2610028H24Rik n/a
4 TRCN0000177247 GATTCTCATGCAGAACATGAT pLKO.1 414 CDS 100% 0.495 0.347 N 2610028H24Rik n/a
5 TRCN0000198704 CAGCCACTGATTGCACAGATT pLKO.1 301 CDS 100% 4.950 2.970 N 2610028H24Rik n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006514298.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.