Transcript: Mouse XM_006514430.2

PREDICTED: Mus musculus exportin 1 (Xpo1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Xpo1 (103573)
Length:
4933
CDS:
812..4027

Additional Resources:

NCBI RefSeq record:
XM_006514430.2
NBCI Gene record:
Xpo1 (103573)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006514430.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000446624 GATTATGTAGATACGGAAATA pLKO_005 2213 CDS 100% 13.200 10.560 N Xpo1 n/a
2 TRCN0000126576 CGTGTTATCAAAGGTCCGTTT pLKO.1 2044 CDS 100% 4.050 3.240 N Xpo1 n/a
3 TRCN0000126577 GCAGAACATGAACACGAAATA pLKO.1 1021 CDS 100% 13.200 9.240 N Xpo1 n/a
4 TRCN0000447505 TTAGTACTATGGCCATTATTG pLKO_005 3213 CDS 100% 13.200 9.240 N Xpo1 n/a
5 TRCN0000126578 CCAGTTAACAACCAAATGTTT pLKO.1 3710 CDS 100% 5.625 3.938 N Xpo1 n/a
6 TRCN0000126575 CCCAAGTTAAAGCAAAGCATT pLKO.1 1371 CDS 100% 4.950 3.465 N Xpo1 n/a
7 TRCN0000126574 CCCATTGTAAAGCAACTTCAA pLKO.1 4584 3UTR 100% 4.950 3.465 N Xpo1 n/a
8 TRCN0000153235 GCTCAAGAAGTACTGACACAT pLKO.1 947 CDS 100% 4.950 3.465 N XPO1 n/a
9 TRCN0000338462 GCTCAAGAAGTACTGACACAT pLKO_005 947 CDS 100% 4.950 3.465 N XPO1 n/a
10 TRCN0000152787 GCTCATTTGTGAGCCTTCATT pLKO.1 4714 3UTR 100% 0.563 0.394 N XPO1 n/a
11 TRCN0000151579 GCATGCATCAATTCTTGCATA pLKO.1 3634 CDS 100% 0.495 0.347 N XPO1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006514430.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01784 pDONR223 100% 91.5% 98% None (many diffs) n/a
2 ccsbBroad304_01784 pLX_304 0% 91.5% 98% V5 (many diffs) n/a
3 TRCN0000472757 TGCAGTGAAAATAAGCGTGGGTGC pLX_317 14.1% 91.5% 98% V5 (many diffs) n/a
Download CSV