Transcript: Mouse XM_006514517.2

PREDICTED: Mus musculus EMI domain containing 1 (Emid1), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Emid1 (140703)
Length:
1370
CDS:
76..1290

Additional Resources:

NCBI RefSeq record:
XM_006514517.2
NBCI Gene record:
Emid1 (140703)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006514517.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000296032 TACGCGAGGCTTTGAAGATTT pLKO_005 1217 CDS 100% 13.200 9.240 N EMID1 n/a
2 TRCN0000117088 GAAACAATGATTGGGCTCTAT pLKO.1 1261 CDS 100% 4.950 3.465 N EMID1 n/a
3 TRCN0000197917 GAAACAATGATTGGGCTCTAT pLKO.1 1261 CDS 100% 4.950 3.465 N Emid1 n/a
4 TRCN0000198349 GCAGGATAGACTTGATTCTTG pLKO.1 651 CDS 100% 4.950 3.465 N Emid1 n/a
5 TRCN0000177741 CAAAGTGACGTACAAGACAGT pLKO.1 318 CDS 100% 2.640 1.848 N Emid1 n/a
6 TRCN0000177657 CCTTGTACAAAGTGACGTACA pLKO.1 311 CDS 100% 0.405 0.284 N Emid1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006514517.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09520 pDONR223 100% 77.1% 73.3% None (many diffs) n/a
2 ccsbBroad304_09520 pLX_304 0% 77.1% 73.3% V5 (many diffs) n/a
3 TRCN0000472939 TGCCGCAGGGCTCACCCAATTTGA pLX_317 14.9% 77.1% 73.3% V5 (many diffs) n/a
Download CSV