Transcript: Mouse XM_006514603.2

PREDICTED: Mus musculus NudC domain containing 3 (Nudcd3), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Nudcd3 (209586)
Length:
3548
CDS:
338..1285

Additional Resources:

NCBI RefSeq record:
XM_006514603.2
NBCI Gene record:
Nudcd3 (209586)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006514603.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000137257 GAAAGTCCATGAGATGCTGAA pLKO.1 1174 CDS 100% 4.050 5.670 N NUDCD3 n/a
2 TRCN0000178035 GCTGGTTCATTGTAGGCATTT pLKO.1 2608 3UTR 100% 10.800 7.560 N Nudcd3 n/a
3 TRCN0000200250 CCATCCGTGAGAACTACATCT pLKO.1 897 CDS 100% 4.950 3.465 N Nudcd3 n/a
4 TRCN0000138791 GATTCAGGAGCAGTTCCAGAA pLKO.1 853 CDS 100% 4.050 2.835 N NUDCD3 n/a
5 TRCN0000197800 GAAGAAAGAACTAGAAGAGAA pLKO.1 577 CDS 100% 4.950 2.970 N Nudcd3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006514603.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15758 pDONR223 0% 41.9% 42.9% None (many diffs) n/a
2 ccsbBroad304_15758 pLX_304 0% 41.9% 42.9% V5 (many diffs) n/a
3 TRCN0000470223 GAACTAGAACGTTTAAATTAGATA pLX_317 76.1% 41.9% 42.9% V5 (many diffs) n/a
Download CSV