Transcript: Mouse XM_006514893.3
PREDICTED: Mus musculus mitochondrial translational initiation factor 2 (Mtif2), transcript variant X3, mRNA.
- Source:
- NCBI, updated 2016-06-22
- Taxon:
- Mus musculus (mouse)
- Gene:
- Mtif2 (76784)
- Length:
- 1959
- CDS:
- 187..1932
Additional Resources:
- NCBI RefSeq record:
- XM_006514893.3
- NBCI Gene record:
- Mtif2 (76784)
sgRNA constructs matching this transcript (CRISPRko, NGG PAM)
This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.
shRNA constructs matching this transcript with 100% SDR[?]The SDR or "Specificity-Defining Region" encompasses the 19 bases within the shRNA stem region that are retained during siRNA processing/production. These are thus the bases that define the target specificity of the shRNA. Note that, while our shRNA designs nearly always extend the stem by two additional bases matching the intended target transcript (reported in the "Target Seq" column), these additional bases are not relevant to target specificity. match
This list includes all shRNAs that have a perfect SDR[?]The SDR or "Specificity-Defining Region" encompasses the 19 bases within the shRNA stem region that are retained during siRNA processing/production. These are thus the bases that define the target specificity of the shRNA. Note that, while our shRNA designs nearly always extend the stem by two additional bases matching the intended target transcript (reported in the "Target Seq" column), these additional bases are not relevant to target specificity. match to Mouse XM_006514893.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).
| Clone ID | Target Seq | Vector | Match Position | Match Region[?]The region of the transcript where the match occurs (5UTR, CDS, 3UTR). NOTE: all matches to non-coding transcripts are labeled 3UTR. | SDR Match %[?]Percent match of the "Specificity-Defining Region" of the hairpin target sequence to transcript RNA sequence. The SDR is defined as the initial 19 bases of the (21mer) target sequence.
|
Intrinsic Score[?]Also called "original score", this assesses the target sequence for predicted cloneability and knockdown performance. | Adjusted Score[?]Also called "specificity score", this is a function of the intrinsic score and the specificity factor. | Matches Other Mouse Gene?[?]Does this construct also match another Mouse gene an equal or better degree? | Orig. Target Gene[?]The gene that this construct was originally designed to target | Addgene[?]Link to this entity's page in the Addgene catalog, if available | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 1 | TRCN0000054411 | GCCATTGACGTAGATTCATTA | pLKO.1 | 109 | 5UTR | 100% | 13.200 | 18.480 | N | Mtif2 | n/a | ||||||||
| 2 | TRCN0000302347 | GCCATTGACGTAGATTCATTA | pLKO_005 | 109 | 5UTR | 100% | 13.200 | 18.480 | N | Mtif2 | n/a | ||||||||
| 3 | TRCN0000054410 | CGGGAGATCAAGTCATTTGTT | pLKO.1 | 1862 | CDS | 100% | 5.625 | 4.500 | N | Mtif2 | n/a | ||||||||
| 4 | TRCN0000302293 | CGGGAGATCAAGTCATTTGTT | pLKO_005 | 1862 | CDS | 100% | 5.625 | 4.500 | N | Mtif2 | n/a | ||||||||
| 5 | TRCN0000054409 | CCCACGAATGTGAACTCGAAT | pLKO.1 | 1370 | CDS | 100% | 4.950 | 3.960 | N | Mtif2 | n/a | ||||||||
| 6 | TRCN0000302349 | CCCACGAATGTGAACTCGAAT | pLKO_005 | 1370 | CDS | 100% | 4.950 | 3.960 | N | Mtif2 | n/a | ||||||||
| 7 | TRCN0000054412 | GCAGAAATCTTGGAACTGAAA | pLKO.1 | 772 | CDS | 100% | 4.950 | 3.465 | N | Mtif2 | n/a | ||||||||
| 8 | TRCN0000302348 | GCAGAAATCTTGGAACTGAAA | pLKO_005 | 772 | CDS | 100% | 4.950 | 3.465 | N | Mtif2 | n/a |
shRNA constructs with at least a near match to this transcript
This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?]The SDR or "Specificity-Defining Region" encompasses the 19 bases within the shRNA stem region that are retained during siRNA processing/production. These are thus the bases that define the target specificity of the shRNA. Note that, while our shRNA designs nearly always extend the stem by two additional bases matching the intended target transcript (reported in the "Target Seq" column), these additional bases are not relevant to target specificity. match to the transcript XM_006514893.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.