Transcript: Mouse XM_006515148.1

PREDICTED: Mus musculus E2F transcription factor 6 (E2f6), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
E2f6 (50496)
Length:
2359
CDS:
278..991

Additional Resources:

NCBI RefSeq record:
XM_006515148.1
NBCI Gene record:
E2f6 (50496)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006515148.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000084241 GTATGTAACCTATCAGGATAT pLKO.1 715 CDS 100% 10.800 15.120 N E2f6 n/a
2 TRCN0000084240 GCGTATGTAACCTATCAGGAT pLKO.1 713 CDS 100% 2.640 3.696 N E2f6 n/a
3 TRCN0000302130 GCGTATGTAACCTATCAGGAT pLKO_005 713 CDS 100% 2.640 3.696 N E2f6 n/a
4 TRCN0000084239 GCCTTGGACGAGTTGATTAAA pLKO.1 638 CDS 100% 15.000 10.500 N E2f6 n/a
5 TRCN0000302132 GCCTTGGACGAGTTGATTAAA pLKO_005 638 CDS 100% 15.000 10.500 N E2f6 n/a
6 TRCN0000084238 GCCCAGTGAATGTCTAGCAAA pLKO.1 2162 3UTR 100% 4.950 3.465 N E2f6 n/a
7 TRCN0000302133 GCCCAGTGAATGTCTAGCAAA pLKO_005 2162 3UTR 100% 4.950 3.465 N E2f6 n/a
8 TRCN0000084242 CGGTTTGATGTGTCACTGGTA pLKO.1 359 CDS 100% 2.640 1.848 N E2f6 n/a
9 TRCN0000302066 CGGTTTGATGTGTCACTGGTA pLKO_005 359 CDS 100% 2.640 1.848 N E2f6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006515148.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00471 pDONR223 100% 69.6% 74% None (many diffs) n/a
2 ccsbBroad304_00471 pLX_304 0% 69.6% 74% V5 (many diffs) n/a
3 TRCN0000473822 GAGAAGAATGCTGTACAACCTTGA pLX_317 57.5% 69.6% 74% V5 (many diffs) n/a
Download CSV