Transcript: Mouse XM_006515206.1

PREDICTED: Mus musculus peroxidasin (Pxdn), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pxdn (69675)
Length:
5035
CDS:
593..2947

Additional Resources:

NCBI RefSeq record:
XM_006515206.1
NBCI Gene record:
Pxdn (69675)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006515206.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000251358 TCGAAGCTGGTCCACAGAATA pLKO_005 2967 3UTR 100% 13.200 18.480 N Pxdn n/a
2 TRCN0000217715 GCGGAAAGCACTAAGTGTAAA pLKO.1 2569 CDS 100% 13.200 10.560 N Pxdn n/a
3 TRCN0000251357 ACGATGGCACGTGCAACAATC pLKO_005 741 CDS 100% 10.800 8.640 N Pxdn n/a
4 TRCN0000216702 CCTATGTTGCTACCTCTATTG pLKO.1 180 5UTR 100% 10.800 8.640 N Pxdn n/a
5 TRCN0000251359 ATTTAGCTATGAGGACGATAA pLKO_005 2527 CDS 100% 10.800 7.560 N Pxdn n/a
6 TRCN0000216200 CAATGCTTTCTCCTACCATTT pLKO.1 2485 CDS 100% 10.800 7.560 N Pxdn n/a
7 TRCN0000191867 GAAGGATTCTTGACCATCAAT pLKO.1 41 5UTR 100% 5.625 3.938 N Pxdn n/a
8 TRCN0000202090 CCACAGAATACTTGTGAGCCT pLKO.1 2978 3UTR 100% 0.660 0.462 N Pxdn n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006515206.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489796 TCGCCCCTTGGAGTGATACTTGGT pLX_317 7.2% 44.2% 47.3% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV