Transcript: Mouse XM_006515413.3

PREDICTED: Mus musculus solute carrier family 8 (sodium/calcium exchanger), member 3 (Slc8a3), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Slc8a3 (110893)
Length:
8648
CDS:
6046..7074

Additional Resources:

NCBI RefSeq record:
XM_006515413.3
NBCI Gene record:
Slc8a3 (110893)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006515413.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000068484 CCCAAACTAGAGGTCATCATT pLKO.1 6280 CDS 100% 5.625 3.938 N Slc8a3 n/a
2 TRCN0000166364 CACACACACACACACACACAA pLKO.1 8367 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006515413.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06963 pDONR223 100% 75.5% 81.2% None (many diffs) n/a
2 ccsbBroad304_06963 pLX_304 0% 75.5% 81.2% V5 (many diffs) n/a
3 TRCN0000475701 TTGTACCCCTCCATCTAGGCTCTG pLX_317 40.9% 75.5% 81.2% V5 (many diffs) n/a
Download CSV