Transcript: Mouse XM_006515709.2

PREDICTED: Mus musculus major facilitator superfamily domain containing 7C (Mfsd7c), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mfsd7c (217721)
Length:
2436
CDS:
140..970

Additional Resources:

NCBI RefSeq record:
XM_006515709.2
NBCI Gene record:
Mfsd7c (217721)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006515709.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000098135 GCGAGAATCTTTGTCAGTTAT pLKO.1 1951 3UTR 100% 13.200 9.240 N Mfsd7c n/a
2 TRCN0000098139 CACAGGTATTTGGGATCGTTT pLKO.1 720 CDS 100% 4.950 3.465 N Mfsd7c n/a
3 TRCN0000098138 GCTTTCATTAAGTCAGATCTT pLKO.1 836 CDS 100% 4.950 3.465 N Mfsd7c n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006515709.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03617 pDONR223 100% 45% 45.5% None (many diffs) n/a
2 ccsbBroad304_03617 pLX_304 0% 45% 45.5% V5 (many diffs) n/a
3 TRCN0000469976 GGACTATCAACGTTTCATCCCGAA pLX_317 29.4% 45% 45.5% V5 (many diffs) n/a
Download CSV