Transcript: Mouse XM_006515738.2

PREDICTED: Mus musculus RIKEN cDNA 9030617O03 gene (9030617O03Rik), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
9030617O03Rik (217830)
Length:
2876
CDS:
109..1962

Additional Resources:

NCBI RefSeq record:
XM_006515738.2
NBCI Gene record:
9030617O03Rik (217830)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006515738.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000340050 ATCGGGCACCTACTACTTAAA pLKO_005 1042 CDS 100% 13.200 18.480 N 9030617O03Rik n/a
2 TRCN0000121360 CCGTGAAGAAGCACATTAGAA pLKO.1 1589 CDS 100% 5.625 7.875 N 9030617O03Rik n/a
3 TRCN0000340120 CCGTGAAGAAGCACATTAGAA pLKO_005 1589 CDS 100% 5.625 7.875 N 9030617O03Rik n/a
4 TRCN0000340123 AGACACCGATTCCCATATTAA pLKO_005 1301 CDS 100% 15.000 12.000 N 9030617O03Rik n/a
5 TRCN0000121357 GCCTACTAAATGTTGTTTCAT pLKO.1 2734 3UTR 100% 5.625 4.500 N 9030617O03Rik n/a
6 TRCN0000340121 GCCTACTAAATGTTGTTTCAT pLKO_005 2734 3UTR 100% 5.625 4.500 N 9030617O03Rik n/a
7 TRCN0000121358 CCATATTAACTTACCAAGGAA pLKO.1 1313 CDS 100% 3.000 2.400 N 9030617O03Rik n/a
8 TRCN0000121361 ACCACTGGATTCCCAACACAT pLKO.1 1117 CDS 100% 4.950 3.465 N 9030617O03Rik n/a
9 TRCN0000121359 CCACTGGATTCCCAACACATT pLKO.1 1118 CDS 100% 4.950 3.465 N 9030617O03Rik n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006515738.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.