Transcript: Mouse XM_006515763.2

PREDICTED: Mus musculus CDC42 binding protein kinase beta (Cdc42bpb), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cdc42bpb (217866)
Length:
6765
CDS:
448..5640

Additional Resources:

NCBI RefSeq record:
XM_006515763.2
NBCI Gene record:
Cdc42bpb (217866)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006515763.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000362062 CCGAGACATTCCGTGCATATT pLKO_005 4008 CDS 100% 13.200 18.480 N Cdc42bpb n/a
2 TRCN0000022693 CGATTGAAATCCCAGACCAAA pLKO.1 2110 CDS 100% 4.950 3.960 N Cdc42bpb n/a
3 TRCN0000362004 ACCTTATCCAGAGACTAATAT pLKO_005 1391 CDS 100% 15.000 10.500 N Cdc42bpb n/a
4 TRCN0000362064 GATTCTATCTTTGAGTATTTC pLKO_005 3292 CDS 100% 13.200 9.240 N Cdc42bpb n/a
5 TRCN0000022689 CCAGGATTCTATCTTTGAGTA pLKO.1 3288 CDS 100% 4.950 3.465 N Cdc42bpb n/a
6 TRCN0000022692 GCTAGAAGTAAAGAACGTGAA pLKO.1 2574 CDS 100% 4.050 2.835 N Cdc42bpb n/a
7 TRCN0000022691 CCTCAGATGTTATCCATGCTA pLKO.1 3983 CDS 100% 3.000 2.100 N Cdc42bpb n/a
8 TRCN0000000856 CCACCAAACACTCAACTCCAT pLKO.1 5522 CDS 100% 2.640 1.848 N CDC42BPB n/a
9 TRCN0000022690 GCAGATTCAAACAGGCTCGAA pLKO.1 1951 CDS 100% 2.640 1.848 N Cdc42bpb n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006515763.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.