Transcript: Mouse XM_006515787.3

PREDICTED: Mus musculus transmembrane protein 196 (Tmem196), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tmem196 (217951)
Length:
4078
CDS:
791..1348

Additional Resources:

NCBI RefSeq record:
XM_006515787.3
NBCI Gene record:
Tmem196 (217951)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006515787.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000341835 GAGCACCGCAACTGATGTTTA pLKO_005 1367 3UTR 100% 13.200 18.480 N Tmem196 n/a
2 TRCN0000341836 ATGACAGACAACATGAGTAAT pLKO_005 1345 CDS 100% 13.200 9.240 N Tmem196 n/a
3 TRCN0000341832 CATTGGAGGCATCCTGAATTT pLKO_005 1048 CDS 100% 13.200 9.240 N Tmem196 n/a
4 TRCN0000341833 CCTGCATCACTCTCATGAAAT pLKO_005 1237 CDS 100% 13.200 9.240 N Tmem196 n/a
5 TRCN0000341834 CATCTCGCTTCCATGTCTTTG pLKO_005 1118 CDS 100% 10.800 7.560 N Tmem196 n/a
6 TRCN0000142407 GAGGATGTTCTCAGAAAGGGA pLKO.1 1210 CDS 100% 0.750 0.525 N TMEM196 n/a
7 TRCN0000122729 CTCTCATGAAATGGCTGAGAA pLKO.1 1246 CDS 100% 0.495 0.347 N TMEM196 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006515787.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13474 pDONR223 100% 43.2% 46.4% None (many diffs) n/a
2 ccsbBroad304_13474 pLX_304 0% 43.2% 46.4% V5 (many diffs) n/a
3 TRCN0000467242 TGTCGCACCGGAAGCGTACAAGAA pLX_317 100% 43.2% 46.4% V5 (many diffs) n/a
Download CSV