Transcript: Mouse XM_006515882.2

PREDICTED: Mus musculus estrogen related receptor, beta (Esrrb), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Esrrb (26380)
Length:
3580
CDS:
16..1017

Additional Resources:

NCBI RefSeq record:
XM_006515882.2
NBCI Gene record:
Esrrb (26380)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006515882.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000414260 ACTCAGATTCGATGTACATTG pLKO_005 767 CDS 100% 10.800 15.120 N Esrrb n/a
2 TRCN0000436442 TGACTAAGATCGTCTCGAATC pLKO_005 341 CDS 100% 6.000 8.400 N Esrrb n/a
3 TRCN0000026233 CGATTCATGAAATGCCTCAAA pLKO.1 190 CDS 100% 4.950 6.930 N Esrrb n/a
4 TRCN0000445264 GGACCCAAGAGACATAGATTG pLKO_005 1403 3UTR 100% 10.800 7.560 N Esrrb n/a
5 TRCN0000026168 GCGCAGGTACAAGAAACTCAA pLKO.1 699 CDS 100% 4.950 3.465 N Esrrb n/a
6 TRCN0000026152 GCCGAGGACTATATCATGGAT pLKO.1 619 CDS 100% 3.000 2.100 N Esrrb n/a
7 TRCN0000022205 GCACAAACTCTTCCTGGAGAT pLKO.1 978 CDS 100% 4.050 2.430 N ESRRB n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006515882.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489270 CTGTCCTGCGTCAGACCGGACGCC pLX_317 26.6% 56.8% 52.5% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000489168 TTGATCATTCCCATAATGTACCAA pLX_317 26.5% 56.8% 52.4% V5 (many diffs) n/a
Download CSV