Transcript: Mouse XM_006515890.3

PREDICTED: Mus musculus MOK protein kinase (Mok), transcript variant X7, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mok (26448)
Length:
4915
CDS:
3671..4672

Additional Resources:

NCBI RefSeq record:
XM_006515890.3
NBCI Gene record:
Mok (26448)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006515890.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000361680 GCTGCGTGTTCTACGAGATTG pLKO_005 3975 CDS 100% 10.800 15.120 N Mok n/a
2 TRCN0000023140 CGGGTTCTACACATACAAGAT pLKO.1 3937 CDS 100% 4.950 6.930 N Mok n/a
3 TRCN0000023139 GCCGGAGAATATCCTAGTAAA pLKO.1 3799 CDS 100% 13.200 10.560 N Mok n/a
4 TRCN0000361605 ATGACCCTGACGAACGAATTG pLKO_005 4212 CDS 100% 10.800 7.560 N Mok n/a
5 TRCN0000368731 CCGGAGAATATCCTAGTAAAG pLKO_005 3800 CDS 100% 10.800 7.560 N Mok n/a
6 TRCN0000023142 GACATCAAACCTCACCTGAAA pLKO.1 4607 CDS 100% 4.950 3.465 N Mok n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006515890.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14824 pDONR223 0% 29.4% 31.1% None (many diffs) n/a
2 ccsbBroad304_14824 pLX_304 0% 29.4% 31.1% V5 (many diffs) n/a
3 TRCN0000472348 TGGACGGTGAACCATGGTTTGCCT pLX_317 47.2% 29.4% 31.1% V5 (many diffs) n/a
4 ccsbBroadEn_13939 pDONR223 100% 29.3% 31.1% None (many diffs) n/a
5 ccsbBroad304_13939 pLX_304 0% 29.3% 31.1% V5 (many diffs) n/a
6 TRCN0000466053 ACTCATTGTGTTAAGAACACACCT pLX_317 45.9% 29.3% 31.1% V5 (many diffs) n/a
Download CSV