Transcript: Mouse XM_006515893.2

PREDICTED: Mus musculus MOK protein kinase (Mok), transcript variant X12, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mok (26448)
Length:
1266
CDS:
211..1023

Additional Resources:

NCBI RefSeq record:
XM_006515893.2
NBCI Gene record:
Mok (26448)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006515893.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000361680 GCTGCGTGTTCTACGAGATTG pLKO_005 500 CDS 100% 10.800 15.120 N Mok n/a
2 TRCN0000023140 CGGGTTCTACACATACAAGAT pLKO.1 462 CDS 100% 4.950 6.930 N Mok n/a
3 TRCN0000023139 GCCGGAGAATATCCTAGTAAA pLKO.1 324 CDS 100% 13.200 10.560 N Mok n/a
4 TRCN0000368731 CCGGAGAATATCCTAGTAAAG pLKO_005 325 CDS 100% 10.800 7.560 N Mok n/a
5 TRCN0000023142 GACATCAAACCTCACCTGAAA pLKO.1 958 CDS 100% 4.950 3.465 N Mok n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006515893.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14824 pDONR223 0% 33.7% 35.9% None (many diffs) n/a
2 ccsbBroad304_14824 pLX_304 0% 33.7% 35.9% V5 (many diffs) n/a
3 TRCN0000472348 TGGACGGTGAACCATGGTTTGCCT pLX_317 47.2% 33.7% 35.9% V5 (many diffs) n/a
4 ccsbBroadEn_13939 pDONR223 100% 33.6% 35.8% None (many diffs) n/a
5 ccsbBroad304_13939 pLX_304 0% 33.6% 35.8% V5 (many diffs) n/a
6 TRCN0000466053 ACTCATTGTGTTAAGAACACACCT pLX_317 45.9% 33.6% 35.8% V5 (many diffs) n/a
Download CSV