Transcript: Mouse XM_006515933.1

PREDICTED: Mus musculus DEAD (Asp-Glu-Ala-Asp) box polypeptide 24 (Ddx24), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ddx24 (27225)
Length:
3091
CDS:
284..2857

Additional Resources:

NCBI RefSeq record:
XM_006515933.1
NBCI Gene record:
Ddx24 (27225)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006515933.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000104064 GCTCGAATCCTTCATAAGAAA pLKO.1 1835 CDS 100% 5.625 7.875 N Ddx24 n/a
2 TRCN0000317018 GCTCGAATCCTTCATAAGAAA pLKO_005 1835 CDS 100% 5.625 7.875 N Ddx24 n/a
3 TRCN0000104063 CCAAGTTTACAGGGATTAATA pLKO.1 1515 CDS 100% 15.000 10.500 N Ddx24 n/a
4 TRCN0000316940 CCAAGTTTACAGGGATTAATA pLKO_005 1515 CDS 100% 15.000 10.500 N Ddx24 n/a
5 TRCN0000104060 GCACACATGTTGTGGAGTTAA pLKO.1 2973 3UTR 100% 13.200 9.240 N Ddx24 n/a
6 TRCN0000305513 TCGGCTCTGGGAGTTAGTTAA pLKO_005 1621 CDS 100% 13.200 9.240 N Ddx24 n/a
7 TRCN0000305512 CCGGTCAATGTGGTGACTGTT pLKO_005 2862 3UTR 100% 4.950 3.465 N Ddx24 n/a
8 TRCN0000104062 GCCCTAGAGATTGAGCTAGAA pLKO.1 2555 CDS 100% 4.950 3.465 N Ddx24 n/a
9 TRCN0000317020 GCCCTAGAGATTGAGCTAGAA pLKO_005 2555 CDS 100% 4.950 3.465 N Ddx24 n/a
10 TRCN0000050316 CGTGACAAACTGGACATCCTT pLKO.1 968 CDS 100% 3.000 2.100 N DDX24 n/a
11 TRCN0000104061 GCTGCCCAGAATGAGTATGAA pLKO.1 620 CDS 100% 5.625 3.375 N Ddx24 n/a
12 TRCN0000312585 CTGAGGATGTGATCAACTTTA pLKO_005 2361 CDS 100% 13.200 9.240 N DDX24 n/a
13 TRCN0000138934 GAAGAGGAGGAGGAAGAAGAA pLKO.1 2791 CDS 100% 4.950 2.475 Y PTMA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006515933.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.