Transcript: Mouse XM_006515953.3

PREDICTED: Mus musculus neuronal cell adhesion molecule (Nrcam), transcript variant X10, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Nrcam (319504)
Length:
11115
CDS:
594..4508

Additional Resources:

NCBI RefSeq record:
XM_006515953.3
NBCI Gene record:
Nrcam (319504)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006515953.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000366146 ATAGATGGCGATACCATTATA pLKO_005 1827 CDS 100% 15.000 21.000 N Nrcam n/a
2 TRCN0000366144 GATTACCTCCGGCCATAATAT pLKO_005 1108 CDS 100% 15.000 21.000 N Nrcam n/a
3 TRCN0000094489 CCTCTCATACTACGGACATAT pLKO.1 4571 3UTR 100% 13.200 18.480 N Nrcam n/a
4 TRCN0000094491 CGGTACAAGTTCTATTTCTAT pLKO.1 3660 CDS 100% 5.625 7.875 N Nrcam n/a
5 TRCN0000094493 CGCACGGAATAAACTAGGGAT pLKO.1 2171 CDS 100% 2.640 3.696 N Nrcam n/a
6 TRCN0000366209 GGCCTACCTACTCCAATTATT pLKO_005 1479 CDS 100% 15.000 10.500 N Nrcam n/a
7 TRCN0000374582 CGGGTTTCCCAAGGCCTAAAT pLKO_005 1170 CDS 100% 13.200 9.240 N Nrcam n/a
8 TRCN0000374651 GAAAGCTCAAGTGCGGTTTAT pLKO_005 1863 CDS 100% 13.200 9.240 N Nrcam n/a
9 TRCN0000374649 GGACACCCGTGAGGACTATAT pLKO_005 1223 CDS 100% 13.200 9.240 N Nrcam n/a
10 TRCN0000094490 CCAGATTTAATCACACTCAAA pLKO.1 1252 CDS 100% 4.950 3.465 N Nrcam n/a
11 TRCN0000094492 GCCTACCTACTCCAATTATTT pLKO.1 1480 CDS 100% 15.000 9.000 N Nrcam n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006515953.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13916 pDONR223 100% 51.7% 53.8% None (many diffs) n/a
2 ccsbBroad304_13916 pLX_304 0% 51.7% 53.8% V5 (many diffs) n/a
3 TRCN0000480317 GCTAACTGTAAACCGCCTCGATGA pLX_317 14.1% 51.7% 53.8% V5 (many diffs) n/a
Download CSV