Transcript: Mouse XM_006516032.3

PREDICTED: Mus musculus solute carrier family 39 (zinc transporter), member 9 (Slc39a9), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Slc39a9 (328133)
Length:
4717
CDS:
387..1085

Additional Resources:

NCBI RefSeq record:
XM_006516032.3
NBCI Gene record:
Slc39a9 (328133)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006516032.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000346749 ATCCCGCTCATCCTATCAATA pLKO_005 1050 CDS 100% 13.200 18.480 N Slc39a9 n/a
2 TRCN0000346750 TAATTGTGTTCGTGGCAATAA pLKO_005 688 CDS 100% 13.200 18.480 N Slc39a9 n/a
3 TRCN0000363871 CTAAAGACGATGGCAACTAAT pLKO_005 1570 3UTR 100% 13.200 9.240 N Slc39a9 n/a
4 TRCN0000346746 GCTGACATACTTAGGATTAAG pLKO_005 830 CDS 100% 13.200 9.240 N Slc39a9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006516032.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08523 pDONR223 100% 67.9% 70% None (many diffs) n/a
2 ccsbBroad304_08523 pLX_304 0% 67.9% 70% V5 (many diffs) n/a
3 TRCN0000470805 GTGCTAACCTGGTGTTCCTGAGCC pLX_317 52.7% 67.9% 70% V5 (many diffs) n/a
Download CSV