Transcript: Mouse XM_006516088.3

PREDICTED: Mus musculus vesicle transport through interaction with t-SNAREs 1B (Vti1b), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Vti1b (53612)
Length:
1169
CDS:
433..948

Additional Resources:

NCBI RefSeq record:
XM_006516088.3
NBCI Gene record:
Vti1b (53612)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006516088.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000070344 CGGTCTGGTGTATTACAAATT pLKO.1 912 CDS 100% 13.200 18.480 N Vti1b n/a
2 TRCN0000351233 CGGTCTGGTGTATTACAAATT pLKO_005 912 CDS 100% 13.200 18.480 N Vti1b n/a
3 TRCN0000070347 ACCTGAAGTATGGCACGTATA pLKO.1 575 CDS 100% 10.800 15.120 N Vti1b n/a
4 TRCN0000351234 ACCTGAAGTATGGCACGTATA pLKO_005 575 CDS 100% 10.800 15.120 N Vti1b n/a
5 TRCN0000070343 CCGGAAGATTCTTCGCTCAAT pLKO.1 822 CDS 100% 4.950 3.960 N Vti1b n/a
6 TRCN0000349289 CCGGAAGATTCTTCGCTCAAT pLKO_005 822 CDS 100% 4.950 3.960 N Vti1b n/a
7 TRCN0000296811 TACCGGAAGGACCTTGCTAAA pLKO_005 499 CDS 100% 0.000 0.000 N VTI1B n/a
8 TRCN0000070345 CCATGATGTCTAAGCTGAGAA pLKO.1 476 CDS 100% 4.950 3.465 N Vti1b n/a
9 TRCN0000349290 CCATGATGTCTAAGCTGAGAA pLKO_005 476 CDS 100% 4.950 3.465 N Vti1b n/a
10 TRCN0000070346 CTCATCGGATTGCCACAGAAA pLKO.1 695 CDS 100% 4.950 3.465 N Vti1b n/a
11 TRCN0000351232 CTCATCGGATTGCCACAGAAA pLKO_005 695 CDS 100% 4.950 3.465 N Vti1b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006516088.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02456 pDONR223 100% 64.7% 67.6% None (many diffs) n/a
2 ccsbBroad304_02456 pLX_304 0% 64.7% 67.6% V5 (many diffs) n/a
3 TRCN0000469044 CCTTAACCTGCATGCTCCTATAGG pLX_317 57.1% 64.7% 67.6% V5 (many diffs) n/a
Download CSV