Transcript: Mouse XM_006516117.2

PREDICTED: Mus musculus RIKEN cDNA 0610007P14 gene (0610007P14Rik), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Erg28 (58520)
Length:
1564
CDS:
475..897

Additional Resources:

NCBI RefSeq record:
XM_006516117.2
NBCI Gene record:
Erg28 (58520)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006516117.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000125252 CTGGTTATGGTGTCCATTATA pLKO.1 508 CDS 100% 15.000 10.500 N Erg28 n/a
2 TRCN0000302524 CTGGTTATGGTGTCCATTATA pLKO_005 508 CDS 100% 15.000 10.500 N Erg28 n/a
3 TRCN0000125251 CTCTCAGAGTTGTTTGTATTT pLKO.1 748 CDS 100% 13.200 9.240 N Erg28 n/a
4 TRCN0000302460 CTCTCAGAGTTGTTTGTATTT pLKO_005 748 CDS 100% 13.200 9.240 N Erg28 n/a
5 TRCN0000125249 CCCTCTATCCTTAAACCATTT pLKO.1 955 3UTR 100% 10.800 7.560 N Erg28 n/a
6 TRCN0000302523 CCCTCTATCCTTAAACCATTT pLKO_005 955 3UTR 100% 10.800 7.560 N Erg28 n/a
7 TRCN0000125250 CCCTGATGGTAGCAAGTTTCT pLKO.1 803 CDS 100% 4.950 3.465 N Erg28 n/a
8 TRCN0000302522 CCCTGATGGTAGCAAGTTTCT pLKO_005 803 CDS 100% 4.950 3.465 N Erg28 n/a
9 TRCN0000125253 GCTCTACACTGGCAAGCCAAA pLKO.1 582 CDS 100% 4.050 2.835 N Erg28 n/a
10 TRCN0000302521 GCTCTACACTGGCAAGCCAAA pLKO_005 582 CDS 100% 4.050 2.835 N Erg28 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006516117.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02636 pDONR223 100% 92.1% 97.8% None (many diffs) n/a
2 ccsbBroad304_02636 pLX_304 0% 92.1% 97.8% V5 (many diffs) n/a
3 TRCN0000472408 CCAATTATCCGGGCCCATCTGCCT pLX_317 95% 92.1% 97.8% V5 (many diffs) n/a
Download CSV