Transcript: Mouse XM_006516162.2

PREDICTED: Mus musculus kinesin family member 26A (Kif26a), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Kif26a (668303)
Length:
6915
CDS:
59..5800

Additional Resources:

NCBI RefSeq record:
XM_006516162.2
NBCI Gene record:
Kif26a (668303)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006516162.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000256391 GTAGCATCAATGACGAGTTTG pLKO_005 3360 CDS 100% 10.800 15.120 N Kif26a n/a
2 TRCN0000256240 TTCGGAAAGGTGAAGGTTATG pLKO_005 1238 CDS 100% 10.800 15.120 N Kif26a n/a
3 TRCN0000256239 GAGATCAAGGTGTACGAAATA pLKO_005 5369 CDS 100% 13.200 9.240 N Kif26a n/a
4 TRCN0000256241 ACGCAAGTGCCTTTAACTTTG pLKO_005 6015 3UTR 100% 10.800 7.560 N Kif26a n/a
5 TRCN0000256392 CATAGCCGTGTCCACGAATTG pLKO_005 4820 CDS 100% 10.800 7.560 N Kif26a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006516162.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14107 pDONR223 100% 8.8% 9.2% None (many diffs) n/a
2 ccsbBroad304_14107 pLX_304 0% 8.8% 9.2% V5 (many diffs) n/a
3 TRCN0000465692 CGTATACTATCCAATCCCGAATTC pLX_317 60.7% 8.8% 9.2% V5 (many diffs) n/a
Download CSV