Transcript: Mouse XM_006516361.2

PREDICTED: Mus musculus autophagy related 2B (Atg2b), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Atg2b (76559)
Length:
4647
CDS:
663..3710

Additional Resources:

NCBI RefSeq record:
XM_006516361.2
NBCI Gene record:
Atg2b (76559)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006516361.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000201401 GCCGTCCGATATGTTGTTAAA pLKO.1 2109 CDS 100% 13.200 18.480 N Atg2b n/a
2 TRCN0000336272 GCTGACCATAACCGCAGTAAA pLKO_005 1424 CDS 100% 13.200 18.480 N Atg2b n/a
3 TRCN0000202165 CGAGGCGACATCAAATGTGTT pLKO.1 3614 CDS 100% 4.950 3.960 N Atg2b n/a
4 TRCN0000336271 GGTGTCAGTCACTAGAGATTT pLKO_005 3913 3UTR 100% 13.200 9.240 N Atg2b n/a
5 TRCN0000200572 CTATGCATTCACTAGTTCAAT pLKO.1 3151 CDS 100% 0.000 0.000 N Atg2b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006516361.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12156 pDONR223 100% 60.6% 63.3% None (many diffs) n/a
2 ccsbBroad304_12156 pLX_304 0% 60.6% 63.3% V5 (many diffs) n/a
Download CSV