Transcript: Mouse XM_006516526.1

PREDICTED: Mus musculus family with sequence similarity 50, member B (Fam50b), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Fam50b (108161)
Length:
1251
CDS:
171..1175

Additional Resources:

NCBI RefSeq record:
XM_006516526.1
NBCI Gene record:
Fam50b (108161)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006516526.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000346999 ATCTCATCCTGCCGCACTATC pLKO_005 919 CDS 100% 10.800 15.120 N Fam50b n/a
2 TRCN0000363883 AGAAGAACTTGGGCAAGAATC pLKO_005 613 CDS 100% 10.800 7.560 N Fam50b n/a
3 TRCN0000346928 CCTGATCAAGAAGCGTGAGAA pLKO_005 218 CDS 100% 4.950 3.465 N Fam50b n/a
4 TRCN0000148395 CGAGAAGAACAAGCACATCTT pLKO.1 1091 CDS 100% 4.950 3.465 N FAM50B n/a
5 TRCN0000346997 TTCGCAGCTGGTACGAGAAGA pLKO_005 1078 CDS 100% 4.950 3.465 N Fam50b n/a
6 TRCN0000346926 ATCGCAGAGGAGACCATCATG pLKO_005 273 CDS 100% 4.950 2.970 N Fam50b n/a
7 TRCN0000149289 GTACGAGAAGAACAAGCACAT pLKO.1 1088 CDS 100% 4.050 2.430 N FAM50B n/a
8 TRCN0000139401 CCTGAATGACATGAAGGCCAA pLKO.1 377 CDS 100% 2.160 1.296 N FAM50A n/a
9 TRCN0000146439 CACCTTCTACGACTTCATCAT pLKO.1 941 CDS 100% 4.950 3.465 N FAM50B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006516526.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02937 pDONR223 100% 84.3% 83.8% None (many diffs) n/a
2 ccsbBroad304_02937 pLX_304 0% 84.3% 83.8% V5 (many diffs) n/a
3 TRCN0000468713 GCCTTATTAATCTTCCATGACCTC pLX_317 35% 84.3% 83.8% V5 (many diffs) n/a
Download CSV