Transcript: Mouse XM_006516807.2

PREDICTED: Mus musculus AT rich interactive domain 4B (RBP1-like) (Arid4b), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Arid4b (94246)
Length:
5789
CDS:
209..4153

Additional Resources:

NCBI RefSeq record:
XM_006516807.2
NBCI Gene record:
Arid4b (94246)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006516807.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000111955 GCCAGTTCAAAGTGTATATTT pLKO.1 4946 3UTR 100% 15.000 21.000 N Arid4b n/a
2 TRCN0000111956 CGCCTTCTTCAGTCACTATAA pLKO.1 3300 CDS 100% 13.200 10.560 N Arid4b n/a
3 TRCN0000341085 CGCCTTCTTCAGTCACTATAA pLKO_005 3300 CDS 100% 13.200 10.560 N Arid4b n/a
4 TRCN0000111957 CGTATCTCAATTCTTCAAGAA pLKO.1 3908 CDS 100% 4.950 3.960 N Arid4b n/a
5 TRCN0000341008 CGTATCTCAATTCTTCAAGAA pLKO_005 3908 CDS 100% 4.950 3.960 N Arid4b n/a
6 TRCN0000111958 CGAAGCCTGATGCTGTATTAA pLKO.1 924 CDS 100% 15.000 10.500 N Arid4b n/a
7 TRCN0000341083 CGAAGCCTGATGCTGTATTAA pLKO_005 924 CDS 100% 15.000 10.500 N Arid4b n/a
8 TRCN0000111959 GCAGAAATGAACTGATTTCAA pLKO.1 2439 CDS 100% 0.563 0.394 N Arid4b n/a
9 TRCN0000341006 GCAGAAATGAACTGATTTCAA pLKO_005 2439 CDS 100% 0.563 0.394 N Arid4b n/a
10 TRCN0000138934 GAAGAGGAGGAGGAAGAAGAA pLKO.1 1832 CDS 100% 4.950 2.475 Y PTMA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006516807.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.