Transcript: Mouse XM_006517049.3

PREDICTED: Mus musculus aryl-hydrocarbon receptor repressor (Ahrr), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ahrr (11624)
Length:
4717
CDS:
456..2177

Additional Resources:

NCBI RefSeq record:
XM_006517049.3
NBCI Gene record:
Ahrr (11624)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006517049.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000089288 CCGAGGCTGTACTTTGCATAA pLKO.1 2528 3UTR 100% 10.800 15.120 N Ahrr n/a
2 TRCN0000089290 CGCTGCTTCATTTGTCGTGTT pLKO.1 717 CDS 100% 4.050 5.670 N Ahrr n/a
3 TRCN0000454564 GAGATGCACAAGTACAGTTAT pLKO_005 1233 CDS 100% 13.200 9.240 N Ahrr n/a
4 TRCN0000454534 GGTCGCTGAGTATGGTTTATG pLKO_005 2583 3UTR 100% 13.200 9.240 N Ahrr n/a
5 TRCN0000445538 GTGTCTCTGAGTACATCATAT pLKO_005 2609 3UTR 100% 13.200 9.240 N Ahrr n/a
6 TRCN0000452735 TTTATGCATCGGCAACAATTG pLKO_005 463 CDS 100% 10.800 7.560 N Ahrr n/a
7 TRCN0000089292 CAAGTCTATGTGAATCAGAAT pLKO.1 982 CDS 100% 4.950 3.465 N Ahrr n/a
8 TRCN0000089289 CGACTCTCATTGTTCTGCATT pLKO.1 849 CDS 100% 4.950 3.465 N Ahrr n/a
9 TRCN0000089291 CCCAGGATATAGTTGAAGCTA pLKO.1 1717 CDS 100% 3.000 2.100 N Ahrr n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006517049.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.