Transcript: Mouse XM_006517085.3

PREDICTED: Mus musculus nuclear receptor subfamily 2, group F, member 1 (Nr2f1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Nr2f1 (13865)
Length:
2124
CDS:
103..1362

Additional Resources:

NCBI RefSeq record:
XM_006517085.3
NBCI Gene record:
Nr2f1 (13865)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006517085.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000350649 GTCCGCAGGAACTTAACTTAC pLKO_005 433 CDS 100% 10.800 15.120 N NR2F1 n/a
2 TRCN0000021739 CGTCCGCAGGAACTTAACTTA pLKO.1 432 CDS 100% 5.625 7.875 N NR2F1 n/a
3 TRCN0000026165 GCAACTCTTCTTCGTACGTTT pLKO.1 1248 CDS 100% 4.950 6.930 N Nr2f1 n/a
4 TRCN0000026160 GAGCAGTTTCAACTGGCCTTA pLKO.1 1320 CDS 100% 4.050 3.240 N Nr2f1 n/a
5 TRCN0000026161 GCTACCTGTCTGGCTACATTT pLKO.1 638 CDS 100% 13.200 9.240 N Nr2f1 n/a
6 TRCN0000026234 CCTCAAAGCCATCGTGCTATT pLKO.1 1053 CDS 100% 10.800 7.560 N Nr2f1 n/a
7 TRCN0000026198 CACATCCGCATCTTTCAGGAA pLKO.1 982 CDS 100% 2.640 1.848 N Nr2f1 n/a
8 TRCN0000021741 CCAGCCCAATCCAGGCCAGTA pLKO.1 582 CDS 100% 0.000 0.000 N NR2F1 n/a
9 TRCN0000322963 CCAGCCCAATCCAGGCCAGTA pLKO_005 582 CDS 100% 0.000 0.000 N NR2F1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006517085.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000492178 TACGTTGGACATGGCCCACATCTG pLX_317 10.7% 94.4% 98.8% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000489296 AGCCGAGAAACCGAAGATGCCCTT pLX_317 17.3% 94.2% 98.5% V5 (many diffs) n/a
Download CSV