Construct: ORF TRCN0000492178
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF021552.2_s317c1
- DNA Barcode:
- TACGTTGGACATGGCCCACATCTG
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- NR2F1 (7025)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000492178
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 7025 | NR2F1 | nuclear receptor subfamily ... | NM_005654.6 | 100% | 100% | |
| 2 | human | 7026 | NR2F2 | nuclear receptor subfamily ... | NM_021005.4 | 79.7% | 84.3% | (many diffs) |
| 3 | human | 7025 | NR2F1 | nuclear receptor subfamily ... | XM_017009797.1 | 63.9% | 63.5% | (many diffs) |
| 4 | human | 7026 | NR2F2 | nuclear receptor subfamily ... | NM_001145155.2 | 54% | 60.7% | (many diffs) |
| 5 | human | 7026 | NR2F2 | nuclear receptor subfamily ... | NM_001145156.1 | 52.4% | 58.8% | (many diffs) |
| 6 | human | 7026 | NR2F2 | nuclear receptor subfamily ... | NM_001145157.2 | 52.4% | 58.8% | (many diffs) |
| 7 | mouse | 13865 | Nr2f1 | nuclear receptor subfamily ... | NM_010151.3 | 94.6% | 99% | (many diffs) |
| 8 | mouse | 13865 | Nr2f1 | nuclear receptor subfamily ... | XM_006517085.3 | 94.4% | 98.8% | (many diffs) |
| 9 | mouse | 11819 | Nr2f2 | nuclear receptor subfamily ... | NM_009697.3 | 80.3% | 84.3% | (many diffs) |
| 10 | mouse | 13865 | Nr2f1 | nuclear receptor subfamily ... | NM_001347538.1 | 59.6% | 63.5% | (many diffs) |
| 11 | mouse | 13865 | Nr2f1 | nuclear receptor subfamily ... | XM_017315378.1 | 59.6% | 63.5% | (many diffs) |
| 12 | mouse | 13865 | Nr2f1 | nuclear receptor subfamily ... | NM_001347539.1 | 57.8% | 62.1% | (many diffs) |
| 13 | mouse | 11819 | Nr2f2 | nuclear receptor subfamily ... | XM_006540577.3 | 53.8% | 60.5% | (many diffs) |
| 14 | mouse | 11819 | Nr2f2 | nuclear receptor subfamily ... | NM_183261.3 | 53.7% | 60.7% | (many diffs) |
| 15 | mouse | 11819 | Nr2f2 | nuclear receptor subfamily ... | XM_006540578.1 | 52.1% | 58.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 1341
- ORF length:
- 1269
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catggcaatg gtagttagca gctggcgaga tccgcaggac gacgtggccg 121 ggggcaaccc cggcggcccc aaccccgcag cgcaggcggc ccgcggcggc ggcggcggcg 181 ccggcgagca gcagcagcag gcgggctcgg gcgcgccgca cacgccgcag accccgggcc 241 agcccggagc gcccgccacc cccggcacgg cgggggacaa gggccagggc ccgcccggtt 301 cgggccagag ccagcagcac atcgagtgcg tggtgtgcgg ggacaagtcg agcggcaagc 361 actacggcca attcacctgc gagggctgca aaagtttctt caagaggagc gtccgcagga 421 acttaactta cacatgccgt gccaacagga actgtcccat cgaccagcac caccgcaacc 481 agtgccaata ctgccgcctc aagaagtgcc tcaaagtggg catgaggcgg gaagcggttc 541 agcgaggaag aatgcctcca acccagccca atccaggcca gtacgcactc accaacgggg 601 accccctcaa cggccactgc tacctgtccg gctacatctc gctgctgctg cgcgccgagc 661 cctaccccac gtcgcgctac ggcagccagt gcatgcagcc caacaacatt atgggcatcg 721 agaacatctg cgagctggcc gcgcgcctgc tcttcagcgc cgtcgagtgg gcccgcaaca 781 tccccttctt cccggatctg cagatcaccg accaggtgtc cctgctacgc ctcacctgga 841 gcgagctgtt cgtgctcaac gcggcccagt gctctatgcc gctgcacgtg gcgccgttgc 901 tggccgccgc cggcctgcat gcctcgccca tgtctgccga ccgcgtcgtg gccttcatgg 961 accacatccg catcttccag gagcaggtgg agaagctcaa ggcgctacac gtcgactcag 1021 ccgagtacag ctgcctcaaa gccatcgtgc tgttcacgtc agacgcctgt ggcctgtcgg 1081 atgcggccca catcgagagc ctgcaggaga agtcgcagtg cgcactggag gagtacgtga 1141 ggagccagta ccccaaccag cccagccgtt ttggcaaact gctgctgcga ctgccctcgc 1201 tgcgcaccgt gtccTCCTCC GTCATCGAGC AGCTCTTCTT CGTCCGTTTG GTAGGTAAAA 1261 CCCCCATCGA AACTCTCATC CGCGATATGT TACTGTCTGG GAGCAGCTTC AACTGGCCTT 1321 ACATGTCCAT CCAGTGCTCC TAGAACCCAG CTTTCTTGTA CAAAGTGGTT GATATCGGTA 1381 AGCCTATCCC TAACCCTCTC CTCGGTCTCG ATTCTACGTA GTAATGAACT AGTCCGTAAC 1441 TTGAAAGTAT TTCGATTTCT TGGCTTTATA TATCTTGTGG AAAGGACGAT ACGTTGGACA 1501 TGGCCCACAT CTGACGCGTT AAGTCgacaa tcaacctctg gattacaaaa tttgtgaaag 1561 att