Transcript: Mouse XM_006517117.1

PREDICTED: Mus musculus SMAD family member 5 (Smad5), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Smad5 (17129)
Length:
6586
CDS:
288..1685

Additional Resources:

NCBI RefSeq record:
XM_006517117.1
NBCI Gene record:
Smad5 (17129)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006517117.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000436791 CCAACCCAACAACGCTCCTTT pLKO_005 821 CDS 100% 4.950 3.960 N Smad5 n/a
2 TRCN0000443789 GGACCTGGAAGTCCATTTCAA pLKO_005 915 CDS 100% 5.625 3.938 N Smad5 n/a
3 TRCN0000068270 CTCACCAAGATGTGTACCATT pLKO.1 1503 CDS 100% 4.950 3.465 N Smad5 n/a
4 TRCN0000068272 GAAGAAGAAGAAGGGTGCTAT pLKO.1 413 CDS 100% 4.950 3.465 N Smad5 n/a
5 TRCN0000068268 GCCGAGTAAATCCTCTGCTAT pLKO.1 5300 3UTR 100% 4.950 3.465 N Smad5 n/a
6 TRCN0000068269 GCCTATGGATACAAGCAGTAA pLKO.1 1004 CDS 100% 4.950 3.465 N Smad5 n/a
7 TRCN0000068271 CCCAGATAATTCCCAGCCTAT pLKO.1 989 CDS 100% 4.050 2.835 N Smad5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006517117.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00963 pDONR223 100% 91.6% 98.9% None (many diffs) n/a
2 ccsbBroad304_00963 pLX_304 43.3% 91.6% 98.9% V5 (many diffs) n/a
3 TRCN0000472920 CCCATACCGGCAAATACTACCACT pLX_317 39.3% 91.6% 98.9% V5 (many diffs) n/a
Download CSV